Stockholm Format
See also:
Stockholm format is a Multiple sequence alignment format used by Pfam and Rfam to disseminate protein and RNA sequence alignments[1][2][3]. The alignment editors Ralee and Belvu support Stockholm format as do the probabilistic database search tools, Infernal and HMMER. A simple example of an Rfam alignment (UPSK RNA) in Stockholm format is shown below:
# STOCKHOLM 1.0
AF035635.1/619-641 UGAGUUCUCGAUCUCUAAAAUCG
M24804.1/82-104 UGAGUUCUCUAUCUCUAAAAUCG
J04373.1/6212-6234 UAAGUUCUCGAUCUUUAAAAUCG
M24803.1/1-23 UAAGUUCUCGAUCUCUAAAAUCG
#=GC SS_cons .AAA....<<<<aaa....>>>>
//
A minimal well formed Stockholm files should contain the header
which states the format and version identifier, currently '# STOCKHOLM
1.0'. Followed by the sequences and corresponding unique sequence names:
<seqname> <aligned sequence>
<seqname> <aligned sequence>
<seqname> <aligned sequence>
'<seqname>' stands for "sequence name", typically in the form
"name/start-end" or just "name". Finally, the "//" line indicates the
end of the alignment. Sequence letters may include any characters
except whitespace. Gaps may be indicated by "." or "-".
The alignment mark-up:
Mark-up lines may include any characters except whitespace. Use underscore ("_") instead of space.
#=GF <feature> <Generic per-File annotation, free text>
#=GC <feature> <Generic per-Column annotation, exactly 1 char per column>
#=GS <seqname> <feature> <Generic per-Sequence annotation, free text>
#=GR <seqname> <feature> <Generic per-Sequence AND per-Column markup, exactly 1 char per column>
Magic or recommended features:
#=GF
(See Pfam documentation, under "Description of fields")
For embedding trees:
#=GF NH <tree in New Hampshire eXtended format>
#=GF TN <Unique identifier for the next tree>
- Notes: A tree may be stored on multiple #=GF NH lines.
- If multiple trees are stored in the same file, each tree must be
preceded by a #=GF TN line with a unique tree identifier. If only one
tree is included, the #=GF TN line may be omitted.
#=GC
The same features as for #=GR with "_cons" appended, meaning "consensus". Example: "SS_cons".
#=GS
Rfam and Pfam uses these features:
Feature Description
--------------------- -----------
AC <accession> ACcession number
DE <freetext> DEscription
DR <db>; <accession>; Database Reference
OS <organism> OrganiSm (species)
OC <clade> Organism Classification (clade, etc.)
LO <look> Look (Color, etc.)
#=GR
Feature Description Markup letters
------- ----------- --------------
SS Secondary Structure For RNA [.,;<>(){}[]AaBb...],
For protein [HGIEBTSCX]
SA Surface Accessibility [0-9X]
(0=0%-10%; ...; 9=90%-100%)
TM TransMembrane [Mio]
PP Posterior Probability [0-9*]
(0=0.00-0.05; 1=0.05-0.15; *=0.95-1.00)
LI LIgand binding [*]
AS Active Site [*]
IN INtron (in or after) [0-2]
- Note: Do not use multiple lines with the same #=GR label. Only one unique feature assignment can be made for each sequence.
- "X" in SA and SS means "residue with unknown structure".
- In SS the letters are taken from DSSP: H=alpha-helix, G=3/10-helix,
I=p-helix, E=extended strand, B=residue in isolated b-bridge, T=turn,
S=bend, C=coil/loop.)
Recommended placements:
- #=GF Above the alignment
- #=GC Below the alignment
- #=GS Above the alignment or just below the corresponding sequence
- #=GR Just below the corresponding sequence
Size limits:
- No size limits on any field.
- However, a simple parser that uses fixed field sizes should work safely on Pfam alignments with these limits:
-
- Line length: 10000.
- <seqname>: 255.
- <feature>: 255.
References
- ^ Griffiths-Jones
S, Moxon S, Marshall M, Khanna A, Eddy SR, Bateman A (2005). "Rfam:
annotating non-coding RNAs in complete genomes.". Nucleic Acids Res 33 (Database issue): D121-4. PMID 15608160.
- ^ Griffiths-Jones S, Bateman A, Marshall M, Khanna A, Eddy SR (2003). "Rfam: an RNA family database.". Nucleic Acids Res 31 (1): 439-41. PMID 12520045.
- ^ Finn
RD, Tate J, Mistry J, Coggill PC, Sammut SJ, Hotz HR, Ceric G, Forslund
K, Eddy SR, Sonnhammer EL, Bateman A (2008). "The Pfam protein families
database.". Nucleic Acids Res 36 (Database issue): D281-8. PMID 18039703.
External links
This article is licensed under the GNU Free Documentation License. It uses material from Wikipedia Encyclopedia article "Stockholm Format"
|
|